commit dbb2bb78577af39dd3df7f903f1b3dbf7154bfa2
parent d42924645af9c35465d4309a264504ad6a17d161
Author: walther chen <walther.chen@gmail.com>
Date: Mon, 17 Mar 2025 11:04:40 +0700
temporarily fix issue with nested pools by removing nested pool
Diffstat:
1 file changed, 16 insertions(+), 15 deletions(-)
diff --git a/util-frequency.c3 b/util-frequency.c3
@@ -34,8 +34,10 @@ fn FrequencyTable frequency_table(String text, int k, Allocator alloc = allocato
kmer_counts.init(allocator: alloc);
for (int i = 0; i <= text.len - k; i += 1) {
// TODO get_or_update? Annoying to get twice
- kmer_counts.@get_or_set(text[i:k], 0); // don't need to clone, keys copied into table
- if (try int* count = kmer_counts.get_ref(text[i:k])) {
+ // Modified std so that hashmap doesn't copy keys
+ String key = text[i:k].copy(alloc);
+ kmer_counts.@get_or_set(key, 0);
+ if (try count = kmer_counts.get_ref(key)) {
*count += 1;
}
}
@@ -50,21 +52,20 @@ fn String[] clump_finding(
Allocator alloc = allocator::heap())
{
if (k == 0 || genome.len == 0) return {};
- String[] res;
+ HashMap{String, char} clumps; // a set
@pool(alloc) {
- HashMap{String, char} clumps; // a set
clumps.tinit();
for (int i = 0; i <= genome.len - region_len; i += 1) {
- @pool(alloc) {
- FrequencyTable freq_map = frequency_table(genome[i:region_len], k, allocator::temp());
- freq_map.@each(; String kmer, int count) {
- if (count >= clump_threshold) {
- // TODO can probably just use a growable array on small inputs
- // Also, careful: hashmap copies keys! Here that means keys copied
- // to temp allocator.
- clumps.set(kmer, 0);
- }
- };
+ // TODO Could use another pool here, but there appears to be a bug with nested pools
+ FrequencyTable freq_map = frequency_table(genome[i:region_len], k, tmem());
+ freq_map.@each(; String kmer, int count) {
+ if (count >= clump_threshold) {
+ // TODO can probably just use a growable array on small inputs
+ // std hashmap modified to not copy keys, so have to copy out kmer from
+ // frequency table
+ String key = kmer.copy(alloc);
+ clumps.set(key, 0);
+ }
};
}
return clumps.keys(alloc);
@@ -73,7 +74,7 @@ fn String[] clump_finding(
fn void test_clump_finding() @test {
String input = "CGGACTCGACAGATGTGAAGAACGACAATGTGAAGACTCGACACGACAGAGTGAAGAGAAGAGGAAACATTGTAA";
- assert(clump_finding(input, 5, 50, 4) == {"CGACA", "GAAGA"});
+ assert(clump_finding(input, 5, 50, 4, tmem()) == {"CGACA", "GAAGA"});
}
fn int hamming_distance(String s1, String s2) {
